🚨🧬🚨
We're looking for a specialized Research Assistant to spearhead a project aimed at exploring new RNA therapeutics in diabetes and other metabolic disorders.
Junior or Senior, we're hoping to recruit a highly motivated and self-driven scientist interested in both basic and applied science. 🦄
Dario Valenzano at PRBB
Today we had a great EvoMG Seminar by Dario Valenzano @dvalenzano.bsky.social from FLI, who told us about some of their recent aging work using the fascinating short-lived killifish.
Hosted by @mirimiam.bsky.social
evomedgenomics.com/events/exter...
Last days to apply! Cool project, cool cities! :-)
(Please repost! 🙏)
Happy to share the Biodiversity Cell Atlas white paper, out today in @nature.com. We look at the possibilities, challenges, and potential impacts of molecularly mapping cells across the tree of life.
www.nature.com/articles/s41...
🚨🚨🚨 New review article on #microexons from the lab! A comprehensive recap of the current state of the field by @tahneema.bsky.social.
www.annualreviews.org/content/jour...
🚨🚨🚨
Please RT!
We're looking for a postdoc to join an exciting joint project between our lab @upf.edu & @crg.eu (Barcelona) and the Sander lab @mdc-berlin.bsky.social (Berlin) investigating how alternative splicing and microexons influences the maturation of pancreatic islets.
Deadline: 30/09/25👇
"The main fates after gene duplication are gene loss, redundancy, subfunctionalization and neofunctionalization".
In our new review, @fedemantica.bsky.social and I argue we are missing the most prevalent one: specialization. And the same applies to alternative splicing! 1/7
tinyurl.com/45k7kbmp
The job call is officially open. If you're interested, please apply through this link ASAP! 😃
www.mdc-berlin.de/career/jobs/...
Please RT! 🙏
🐟 Our new paper "Phenotypic impact of individual conserved neuronal microexons and their master regulators in zebrafish" is out in @elife.bsky.social 🐟
A nearly 10-year tour-de-force by Laura Lopez-Blanch and many others in the lab @crg.eu & @upf.edu
elifesciences.org/reviewed-pre...
Thread 👇1/9
🚨🚨🚨
If you're a bioinformatician who loves:
🧬 #SingleCell #LongReadSequencing & #AlternativeSplicing
🚀 Collaborating and travelling
Apply to work with us at the spectacular BIMSB (@mdc-berlin.bsky.social) in Berlin + @upf.edu-@crg.eu in Barcelona. Qs: www.transdevolab.com
Please RT! 🙏
We’re recruiting a PhD student to use comparative omics to investigate why some viruses can efficiently infect both human and mosquito cells, but lead to different infection outcomes. Fully funded position by @evomg-bcn.bsky.social at our lab at UPF-CRG and the Diez lab.
www.crg.eu/en/content/t...
"La importancia de apoyar la investigación en España"
👏👏👏
elpais.com/opinion/2024...
‼ Investigadores españoles dan un paso más en descifrar el misterio del autismo
Who would have thought that an actual sequence of a #microexon (GCAAGGACATATGGGCGAAGGAGA from CPEB4) would be in the headline of an article in @elpais.com! Congrats to the Mendez, @xsalvatella1.bsky.social and @jjlucaslab.bsky.social labs for this amazing work!
english.elpais.com/science-tech...
