Roz Laing and I are looking for a combined lab manager/(PD)RA to contribute to ongoing projects in the lab: initially for 18 months but hopefully a longer-term post, subject to funding. Closing date is 23 March. Please get in touch if you have any questions about the role.
tinyurl.com/246m632j
I discovered by accident that you need to go to builders merchants for blue roll.. on Great Western Road.
www.screwfix.com/p/essentials...
Please also note that only a limited number of NorthwestBio studentships will be funded for international students, so competition for those places is likely to be extremely competitive.
Please note that you *must* apply through the NorthWest Bio system by 4th January at lnkd.in/etRp8szS. Writing to me or the other supervisors won't be counted as a valid application in time.
www.gla.ac.uk/postgraduate...
www.gla.ac.uk/postgraduate...
www.gla.ac.uk/postgraduate...
A slightly late pre-xmas reminder to please apply for these funded PhD positions in parasite genomics/genetics/molecular biology that I'm involved in – the closing date was extended and is now 4th January, so still time to put together an application.
Exciting PhD opportunity on the ecological impacts of anthelmintic use on soil fauna, with a crack supervisory team and expertise from @hutton.ac.uk, @uofglasgow.bsky.social and @moredunfoundation.bsky.social!
More info here: www.findaphd.com/phds/project...
I'm afraid i'm lowkey(generation_x). Proudly part of the first generation to be raised by video games and MTV.
Looking forward to seeing the R code for your next paper...
Come join us - we are recruiting a postdoc in phylodynamics and epidemiological modelling to join an exciting project on foot-and-mouth-disease virus in African buffalo
www.jobs.gla.ac.uk/job/research...
Please share widely!
#jobs #disease #ecology #evolution #phylodynamics
This scheme funds PhD scholarships in Glasgow for black UK-domiciled students. I'm happy to support students interested in my research area, or try and help point potential applicants to more suitable supervisors if your interests don't quite match mine.
Our lab has two funded PhDs to start in 2026 via the NorthWestBio programme
Project details here
www.gla.ac.uk/postgraduate...
...and here
www.gla.ac.uk/postgraduate...
Application deadline is Nov 21st 2025; apply here:
www.gla.ac.uk/postgraduate...
My colleague Roz Laing also has a veterinary parasitology project next year, investigating how epigenetics might be involved in mediating drug resistance in parasitic nematodes www.gla.ac.uk/postgraduate....
#3 Developing improved molecular diagnostics for Cryptosporidium in drinking water, and using these (and some genomics) to understand sources of contamination. Led by Frank Katzer at Moredun and Willie Weir in Glasgow www.gla.ac.uk/postgraduate...
#2 - a project taking a comparative approach to DNA replication and plasticity/mutation in kinetoplastids, expanding work form the 'model' parasites to other kinetoplastid lineages, with Richard McCulloch and Sarah Allinson in Lancaster: www.gla.ac.uk/postgraduate...
I'm also co-supervising a few other projects:
#1: an inter-disciplinary project on chemical biology of Base-J in kinetoplastids, led by Glenn Burley @Strathclyde. We aim to develop some new chemical approaches and apply them to study kinetoplastid genetics.
www.gla.ac.uk/postgraduate...
The link currently has the wrong text, but hopefully will be fixed soon. Please get in touch if you have questions, and apply by 21st November via the NorthWestBio system www.gla.ac.uk/postgraduate...
We have a PhD position in population genomics of sheep scab mites available from October 2026. The project will investigate Psoroptes populations in the context of eradication programs on Scottish island groups and spreading drug resistance. www.gla.ac.uk/postgraduate...
Univariate Regression Road
Non-Parametric Parade
If I ever build a housing estate, there will be no 'Oak Avenue'
Well done Lilly!
Well done Benedict!
We are recruiting!
Applications are open for Senior Lecturer/Lecturer in One Health Microbiology (Research & Teaching Track) grade 7/8/9.
To apply, visit www.jobs.gla.ac.uk/job/senior-l...
#worldchangerswelcome
Academic colleagues, if we claim to value equity, and if it’s currently not safe for *some* of our colleagues to travel to the US for conferences, then should *any* of us be travelling to the US? Standing up for equity isn’t about our own convenience.
Possibly limited engagement. Does your network on here reach enough trilobite systematics influencers?
not completely, but its good that you are so motivated to look less like me.
Did you notice any way people can donate to the 'debt buying company' or similar things? Obviously I don't know the numbers but it seems like could be quite cost-effective philanthropy.
We almost look like twins in our bsky profile pictures.. 😧
@mchshe.bsky.social Reading the Guardian this morning. You seem to be a good man. Your comment on powerlessness really resonated… I need to do more, and am fortunate enough to be able to make some small difference. Well done!
Tapeworm Echinococcus multilocularis: TCGGTCCTTACCTTGCAGTTTTGTATG
doi: 10.1074/jbc.M006091200.
tapeworm Hymenolepis diminuita:
SL1: CGGTCTTACCATAAAACTTGTATG
SL2: CCGGTCTTACCTTGCAATTTTTGTATG
SL3: AATCGGTCTTACTGTACTAACTTGTATG
doi: 10.1186/s12915-020-00899-w.
thats all I can think of just now.
No worries - i'd forgotten the nematode literature on this so nice to remind myself. You did say 'keep it coming'.
