James Cotton's Avatar

James Cotton

@jamesacotton

I try and do comparative and population genomics of neglected tropical disease (and some other) parasites, as part of @sbohvm.gla.ac.uk at the @uofglasgow.bsky.social

578
Followers
311
Following
47
Posts
11.12.2023
Joined
Posts Following

Latest posts by James Cotton @jamesacotton

Research Assistant We have an exciting opportunity for a Research Assistant to contribute to multiple veterinary parasitology projects, working with Professor James Cotton and Dr Roz Laing. The successful candidate w...

Roz Laing and I are looking for a combined lab manager/(PD)RA to contribute to ongoing projects in the lab: initially for 18 months but hopefully a longer-term post, subject to funding. Closing date is 23 March. Please get in touch if you have any questions about the role.

tinyurl.com/246m632j

19.02.2026 19:13 πŸ‘ 1 πŸ” 6 πŸ’¬ 0 πŸ“Œ 0

I discovered by accident that you need to go to builders merchants for blue roll.. on Great Western Road.
www.screwfix.com/p/essentials...

14.02.2026 09:44 πŸ‘ 1 πŸ” 0 πŸ’¬ 0 πŸ“Œ 0

Please also note that only a limited number of NorthwestBio studentships will be funded for international students, so competition for those places is likely to be extremely competitive.

24.12.2025 11:42 πŸ‘ 0 πŸ” 0 πŸ’¬ 0 πŸ“Œ 0
LinkedIn This link will take you to a page that’s not on LinkedIn

Please note that you *must* apply through the NorthWest Bio system by 4th January at lnkd.in/etRp8szS. Writing to me or the other supervisors won't be counted as a valid application in time.

www.gla.ac.uk/postgraduate...

www.gla.ac.uk/postgraduate...

www.gla.ac.uk/postgraduate...

24.12.2025 11:42 πŸ‘ 0 πŸ” 0 πŸ’¬ 1 πŸ“Œ 0
LinkedIn This link will take you to a page that’s not on LinkedIn

A slightly late pre-xmas reminder to please apply for these funded PhD positions in parasite genomics/genetics/molecular biology that I'm involved in – the closing date was extended and is now 4th January, so still time to put together an application.

24.12.2025 11:42 πŸ‘ 0 πŸ” 1 πŸ’¬ 1 πŸ“Œ 0
Preview
Ecological impacts of anthelmintic usage on soil micro- and mesofaunal communities at The James Hutton Institute on FindAPhD.com PhD Project - Ecological impacts of anthelmintic usage on soil micro- and mesofaunal communities at The James Hutton Institute, listed on FindAPhD.com

Exciting PhD opportunity on the ecological impacts of anthelmintic use on soil fauna, with a crack supervisory team and expertise from @hutton.ac.uk, @uofglasgow.bsky.social and @moredunfoundation.bsky.social!

More info here: www.findaphd.com/phds/project...

12.11.2025 12:11 πŸ‘ 2 πŸ” 3 πŸ’¬ 0 πŸ“Œ 0

I'm afraid i'm lowkey(generation_x). Proudly part of the first generation to be raised by video games and MTV.

11.11.2025 16:56 πŸ‘ 1 πŸ” 0 πŸ’¬ 0 πŸ“Œ 0

Looking forward to seeing the R code for your next paper...

11.11.2025 13:46 πŸ‘ 0 πŸ” 0 πŸ’¬ 1 πŸ“Œ 0
Research Assistant/Associate Job PurposeΒ You will contribute to an international collaborative project entitled β€œMulti-scale infection dynamics from cells to landscapes: FMD in African buffalo”, working with Prof Roman Biek. T...

Come join us - we are recruiting a postdoc in phylodynamics and epidemiological modelling to join an exciting project on foot-and-mouth-disease virus in African buffalo
www.jobs.gla.ac.uk/job/research...
Please share widely!
#jobs #disease #ecology #evolution #phylodynamics

09.11.2025 21:11 πŸ‘ 9 πŸ” 7 πŸ’¬ 0 πŸ“Œ 1

This scheme funds PhD scholarships in Glasgow for black UK-domiciled students. I'm happy to support students interested in my research area, or try and help point potential applicants to more suitable supervisors if your interests don't quite match mine.

07.11.2025 21:01 πŸ‘ 0 πŸ” 0 πŸ’¬ 0 πŸ“Œ 0
University of Glasgow - Postgraduate study - Centres for Doctoral Training - NorthWest Biosciences - Our Projects - Understanding Pathogens, from Molecules to Phenotypes - Richard McCulloch

Our lab has two funded PhDs to start in 2026 via the NorthWestBio programme

Project details here
www.gla.ac.uk/postgraduate...
...and here
www.gla.ac.uk/postgraduate...

Application deadline is Nov 21st 2025; apply here:
www.gla.ac.uk/postgraduate...

06.10.2025 13:23 πŸ‘ 10 πŸ” 5 πŸ’¬ 0 πŸ“Œ 0
University of Glasgow - Postgraduate study - Centres for Doctoral Training - NorthWest Biosciences - Our Projects - Understanding Pathogens, from Molecules to Phenotypes - Roz Laing

My colleague Roz Laing also has a veterinary parasitology project next year, investigating how epigenetics might be involved in mediating drug resistance in parasitic nematodes www.gla.ac.uk/postgraduate....

07.10.2025 08:58 πŸ‘ 2 πŸ” 0 πŸ’¬ 0 πŸ“Œ 0
University of Glasgow - Postgraduate study - Centres for Doctoral Training - NorthWest Biosciences - Our Projects - Animal Biology in Health & Disease - Willie Weir

#3 Developing improved molecular diagnostics for Cryptosporidium in drinking water, and using these (and some genomics) to understand sources of contamination. Led by Frank Katzer at Moredun and Willie Weir in Glasgow www.gla.ac.uk/postgraduate...

07.10.2025 08:51 πŸ‘ 1 πŸ” 0 πŸ’¬ 0 πŸ“Œ 0
University of Glasgow - Postgraduate study - Centres for Doctoral Training - NorthWest Biosciences - Our Projects - Understanding Pathogens, from Molecules to Phenotypes - Richard McCulloch

#2 - a project taking a comparative approach to DNA replication and plasticity/mutation in kinetoplastids, expanding work form the 'model' parasites to other kinetoplastid lineages, with Richard McCulloch and Sarah Allinson in Lancaster: www.gla.ac.uk/postgraduate...

07.10.2025 08:48 πŸ‘ 3 πŸ” 1 πŸ’¬ 0 πŸ“Œ 0
University of Glasgow - Postgraduate study - Centres for Doctoral Training - NorthWest Biosciences - Our Projects - Underpinning Bioscience - Glenn A Burley

I'm also co-supervising a few other projects:
#1: an inter-disciplinary project on chemical biology of Base-J in kinetoplastids, led by Glenn Burley @Strathclyde. We aim to develop some new chemical approaches and apply them to study kinetoplastid genetics.
www.gla.ac.uk/postgraduate...

07.10.2025 08:46 πŸ‘ 5 πŸ” 1 πŸ’¬ 0 πŸ“Œ 0
University of Glasgow - Postgraduate study - Centres for Doctoral Training - NorthWest Biosciences - How To Apply NorthWest Bio is a new BBSRC-funded doctoral training partnership. Discover more about the programme and how to apply.

The link currently has the wrong text, but hopefully will be fixed soon. Please get in touch if you have questions, and apply by 21st November via the NorthWestBio system www.gla.ac.uk/postgraduate...

07.10.2025 08:42 πŸ‘ 1 πŸ” 0 πŸ’¬ 0 πŸ“Œ 0
University of Glasgow - Postgraduate study - Centres for Doctoral Training - NorthWest Biosciences - Our Projects - Animal Biology in Health & Disease - James Cotton

We have a PhD position in population genomics of sheep scab mites available from October 2026. The project will investigate Psoroptes populations in the context of eradication programs on Scottish island groups and spreading drug resistance. www.gla.ac.uk/postgraduate...

07.10.2025 08:41 πŸ‘ 4 πŸ” 3 πŸ’¬ 1 πŸ“Œ 1

Univariate Regression Road
Non-Parametric Parade

If I ever build a housing estate, there will be no 'Oak Avenue'

27.06.2025 07:28 πŸ‘ 0 πŸ” 0 πŸ’¬ 0 πŸ“Œ 0

Well done Lilly!

09.05.2025 19:57 πŸ‘ 5 πŸ” 0 πŸ’¬ 0 πŸ“Œ 0

Well done Benedict!

09.05.2025 19:57 πŸ‘ 3 πŸ” 0 πŸ’¬ 0 πŸ“Œ 0
Senior Lecturer/Lecturer in One Health Microbiology (Research & Teaching Track) This is the job description for the Senior Lecturer Grade 9 level. Please note the role is available at a Lecturer Grade 7 and 8 level. Please refer to the separate lecturer Grade 7/8 job descripti...

We are recruiting!

Applications are open for Senior Lecturer/Lecturer in One Health Microbiology (Research & Teaching Track) grade 7/8/9.

To apply, visit www.jobs.gla.ac.uk/job/senior-l...

#worldchangerswelcome

25.04.2025 15:35 πŸ‘ 10 πŸ” 14 πŸ’¬ 0 πŸ“Œ 2
Preview
Where are all the lice? Development and deployment of molecular detection technologies to quantify salmon lice in Scottish waters. at University of Glasgow on FindAPhD.com PhD Project - Where are all the lice? Development and deployment of molecular detection technologies to quantify salmon lice in Scottish waters. at University of Glasgow, listed on FindAPhD.com

PhD Opportunity

www.findaphd.com/phds/project...

24.03.2025 16:50 πŸ‘ 0 πŸ” 2 πŸ’¬ 0 πŸ“Œ 0

Academic colleagues, if we claim to value equity, and if it’s currently not safe for *some* of our colleagues to travel to the US for conferences, then should *any* of us be travelling to the US? Standing up for equity isn’t about our own convenience.

21.03.2025 23:30 πŸ‘ 29 πŸ” 4 πŸ’¬ 3 πŸ“Œ 1

Possibly limited engagement. Does your network on here reach enough trilobite systematics influencers?

10.03.2025 11:12 πŸ‘ 0 πŸ” 0 πŸ’¬ 0 πŸ“Œ 0

not completely, but its good that you are so motivated to look less like me.

10.03.2025 11:10 πŸ‘ 0 πŸ” 0 πŸ’¬ 0 πŸ“Œ 0

Did you notice any way people can donate to the 'debt buying company' or similar things? Obviously I don't know the numbers but it seems like could be quite cost-effective philanthropy.

We almost look like twins in our bsky profile pictures.. 😧

10.03.2025 10:53 πŸ‘ 0 πŸ” 0 πŸ’¬ 2 πŸ“Œ 0

@mchshe.bsky.social Reading the Guardian this morning. You seem to be a good man. Your comment on powerlessness really resonated… I need to do more, and am fortunate enough to be able to make some small difference. Well done!

10.03.2025 10:40 πŸ‘ 2 πŸ” 1 πŸ’¬ 1 πŸ“Œ 0

Tapeworm Echinococcus multilocularis: TCGGTCCTTACCTTGCAGTTTTGTATG
doi: 10.1074/jbc.M006091200.

tapeworm Hymenolepis diminuita:
SL1: CGGTCTTACCATAAAACTTGTATG
SL2: CCGGTCTTACCTTGCAATTTTTGTATG
SL3: AATCGGTCTTACTGTACTAACTTGTATG
doi: 10.1186/s12915-020-00899-w.

thats all I can think of just now.

03.03.2025 17:22 πŸ‘ 0 πŸ” 0 πŸ’¬ 0 πŸ“Œ 0

No worries - i'd forgotten the nematode literature on this so nice to remind myself. You did say 'keep it coming'.

03.03.2025 17:18 πŸ‘ 1 πŸ” 0 πŸ’¬ 1 πŸ“Œ 0