Elle McD

I'M LIVE RIGHT NOW, DONATE FOR TRANS RIGHTS

me when my two favorite things (video essayists and rogue lite deckbuilders) come together to defend my rights 🫶

either I got really lucky again or TSA agents are getting really good at sniffing out trans people I got to skip the penis-detection-machine TWO TIMES IN A ROW 🫡🥹🥳

patdownless vacation would you believe it

fish oil pill was extra sloppy this morning and I had to physically restrain myself from popping it like a gushers between my fingers

*two prokaryotes in 3,700,000,000 BC*

what if we kissed in the primordial stew...

AS SHE SHOULD

who's going to stop me from putting buzzcut season by Lorde on every playlist I own in the year 2024(5)???

my students won't stop asking where the fresh blood sample for our lab is coming from. I'm gonna keep not telling them and keep showing up to school with more bandaids on my fingers until they figure it out

those lizard nails from Holes but instead of killing you they forcefem you

thank you Hank this helps

took my estrogen and got a goodnight kiss. everything is okay now

my stupid dog won't stop reciting the Kybalion when I try to cut his hair,,,
I know you're excited about planar vibration frequencies LET ME TRIM YOUR MUSTACHE PLEASE

incredible how putting on makeup turns a bad day into a bad day with makeup on

I'm going to chop off your unbroken hand, thief

she sequence on my genome till I ATGGCGATCCTAGGTCATGC

I know two authors who told me to buy their book in any way OTHER than using Amazon because it earns them the least money.

Shop local and support indie authors!

i wish there was a song for those of us who are not sick, yet arent entirely well either

engineers be like: *employed*

lore-unfriendly companion that loudly talks over expository cutscenes with the latest drama in the adventurers guild

every time Drew Polovick writes a bass line a really cool bug gets its wings

anyways I'm learning Spectator by FPC right now

⁉️

sorry I couldn't help unload the groceries I was holding space for the lyrics of defy gravity

silly string is just regular string to me