@ensembl.org
The Ensembl project seeks to enable genomic science by providing high-quality, integrated annotation. Vertebrates: www.ensembl.org Non-vertebrates: www.ensemblgenomes.org You can test the new Ensembl browser and share your feedback at beta.ensembl.org
Excited to build cutting-edge web tools for genomic research? Join us at @ensembl.org as a Web Developer. Apply here: www.ensembl.info/2026/03/04/...
Closing date: 25th March 2026
This #RareDiseaseDay we’re highlighting how data sharing supports diagnosis, research & families living with rare conditions.
Watch to find out how access to rare disease data can help families better understand their children’s conditions.
@uniquecharity.bsky.social @geneticallianceuk.bsky.social
Exciting opportunity to join our team!
Job: Genomics Technology Infrastructure Team Leader
Please follow the instructions in the ad to apply (www.ensembl.info/2026/02/17/...).
Closing date: 25/03/2026
Ensembl release 116 & Ensembl Genomes release 63 are coming in April 2026!
Read more in our declaration of intentions blog:
www.ensembl.info/2026/02/12/...
From summer 2026, ensembl.org redirects to beta.ensembl.org. Previous versions remain in Ensembl Archives.
If you haven't shared your views on future genomics training & events yet, do it soon for a chance to win. 👀
Once completed, you'll be entered into a prize draw for a chance to win 1 of 3 registration passes (incl. accommodation) to a Connecting Science conference of your choice. 🎉
Link below ⤵️
Photographs of the Festival of Genomics banner and Genome Dome session agenda.
We are at the Festival of Genomics in London! Join #Ensembl at the “Genome Dome” at 16:00 today to learn about latest new genomes and annotations available via beta.ensembl.org
#FOG2026
Get to know the people behind Ensembl and meet Disha Lodha from the Ensembl Plants & Metazoa team in our latest #Teamsembl blog post at www.ensembl.info/2026/01/27/...
Exciting opportunity at Ensembl!
We’re hiring a Bioinformatics developer to contribute to the development of the Ensembl Variant Effect Predictor (VEP).
More info: www.ensembl.info/2026/01/22/...
#Jobs #bioinformatics
Recruitment for the EMBL International PhD Programme is officially open! 🔊
At EMBL, we train young scientists to become skilled and creative future leaders in academia, industry and other sectors. Start your career in the life sciences with us!
🔎 Read more here:
tinyurl.com/4jdt2ra5
Exciting opportunity at Ensembl!
We’re hiring a Bioinformatician to help drive large-scale genomics and generate gene annotation for GENCODE or PARADIGM.
More info: www.ensembl.info/2026/01/05/...
Service notice - we are working on server issues affecting the Ensembl mirror sites. Workaround - ensembl.org?redirect=no or an archive may2025.archive.ensembl.org/. You can try the new Ensembl site at beta.ensembl.org and let us know about the features you would like to see!
How can animal genomics communities coordinate data resources? Garth Ilsley presents with highlights from the FAANG and Ensembl Regulation data portals #PAG33
Uniprot @uniprot is developing new strategies and workflows for reference proteomes of agricultural species - Pedro Raposo presents at #PAG33
Elspeth Bruford presents on gene naming by the HUGO gene nomenclature committee, over 44000 genes named to date! “Nomenclature should not be offensive or pejorative”! @hgnc.bsky.social #PAG33
New long transcriptomic data are introducing complexities and opportunities into manual genome annotation! Jane Loveland @janeloveland.bsky.social shares new insights @gencodegenes.bsky.social #PAG33
José Pérez-Silva @jgperezsilva.bsky.social presents on gene annotation methods used by Ensembl at #PAG33
If you're in sunny San Diego for #PAG33, join us at our workshop, “Integrated Genome Resources at EMBL-EBI”, to learn more about our exciting new features and data resources for genomics and pangenomics!
It's on Sunday 11 January from 8:00– 12:00, we hope to see you there!
Photographs of the nine-banded armadillo and common buzzard.
New #GeneAnnotation has been added to #Ensembl Beta, including annotation for Dasypus novemcinctus and Buteo buteo!
You can explore all available species here: beta.ensembl.org/species-sel...
Image credits:
commons.wikimedia.org/wiki/F...
commons.wikimedia.org/wiki/F...
Hello, happy New Year!
Three roles are currently open at Ensembl:
Genomic Data Analyst
Closing date: 10 Jan 2026
Genomic Data Analyst Project Lead
Closing date: 10 Jan 2026
Senior Platform Developer
Closing date: 24 Jan 2026
More info on current vacancies here (www.ensembl.info/category/06-...)
The HAVANA team at EMBL-EBI has multiple open positions to support the GENCODE and PARADIGM projects. We're recruiting gene annotators (bit.ly/4qG28g5), an annotation project lead (bit.ly/4qv05v6), and bioinformaticians (bit.ly/4qevYIY). Please apply via the links. We’d love to hear from you!
Riddle number two of the day: this photo was taken at the very last stop of our final Ensembl workshop of the year… can you guess where?
From all of us at Ensembl, we wish you holidays filled with "ATGGAACGCCGCATTATGGAAAACACCGCGAACGATCCGGAAGCGTGCGAA"
May your celebrations be as perfectly in‑frame as your favourite gene.
Ensembl Job alert! Bioinformatics Developer in Ensembl Compara
Apply here: www.ensembl.info/2025/12/10/...
Closing date: 12 January 2026
Graphic with a 10 surrounded by fireworks and the Open Targets Platform logo
#OnThisDay 10 years ago, we launched the Open Targets Platform! 🎂 🧬🖥️
In Nov, @aleenamolbio.bsky.social from Ensembl Outreach visited Uni Valle Colombia to introduce 100 students from 3 public schools in Valle del Cauca to EMBL-EBI research & open-access bioinformatics training. Inspiring the next generation of scientists! 🌱🔬 #STEM #Bioinformatics #Outreach
Attention developers and researchers working with Ensembl programmatically! Upcoming Ensembl API and data access changes are live on our blog. Read more about the new platform, new services, and migration timelines here: www.ensembl.info/2025/12/02/...
Our Ensembl 2026 paper is out!
Learn about 1,900+ new genomes, expanded pangenome support, new regulation interfaces, and what’s coming in our 2026 releases.
doi.org/10.1093/nar/gkaf1239
New datasets available on beta.ensembl.org! Highlights include oats from the PanOat project, human assemblies from HPRC Release 2 and the pocket water lily, submitted by
Fujian Agriculture and Forestry University
Image credit - commons.wikimedia.org/wiki/F...
New Webinar: This Wednesday, join speakers Jorge Barista da Rocha, PhD, and Jane Loveland, PhD, as they explore the @ensembl.org genome browser and provide practical skills beyond the traditional reference genome. Register here: bit.ly/432kP4b #ASHG #HumanGenetics @gencodegenes.bsky.social
Antimicrobial resistance (AMR) is a growing health threat, making infections harder to treat and complicating routine medical care.
EMBL-EBI’s new AMR portal brings together laboratory resistance data and bacterial genomes in one open platform.
#WAAW2025 #ActOnAMR
www.ebi.ac.uk/about/news/t...
🧬💻
