#microExon

Manuel Irimia

@mirimiam.bsky.social

7 months ago

Core splicing architecture and early spliceosomal recognition determine microexon sensitivity to SRRM3/4 Nature Structural & Molecular Biology - Using massively parallel splicing assays and mathematical modeling, Bonnal et al. uncover that conserved splice site strength and exon length encode...

Very happy to share the peer-reviewed version of our work on the cis-regulatory determinants of #microexon #splicing regulation by SRRM3/4, published in @natsmb.nature.com!

rdcu.be/ezGqT

Work led by @sobonnal.bsky.social, with Simon Bajew & @rmartinezcorral.bsky.social. @crg.eu @upf.edu

Jose Lucas Lab

@jjlucaslab.bsky.social

1 year ago

ENTREVISTA | José Javier Lucas: "Encontrar terapias para el autismo nos mueve a todos, a los investigadores también" El profesor Lucas es parte esencial del prometedor hallazgo que relaciona la proteína CPEB4 y el autismo: "Una legión de investigadores nos dejamos el pellejo en generar conocimiento que tendrá una ap...

Gracias @melisatuya.bsky.social por visibilizar nuestro trabajo sobre el papel de CPEB4 y su #microexon en el #autismo.
www.20minutos.es/noticia/5664...
Estudios colaborativos con grupos españoles e internacionales
@irbbarcelona.org @mirimiam.bsky.social @cbm-csic-uam.bsky.social @sebbm.bsky.social

Milo B. Fasken, Ph.D.

@milofasken.bsky.social

1 year ago

Interesting!
#microExon #RBP #Autism #Splicing

Manuel Irimia

@mirimiam.bsky.social

1 year ago

The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA A team of Spanish scientists has discovered the mechanism that could explain a high percentage of autism spectrum disorders

Who would have thought that an actual sequence of a #microexon (GCAAGGACATATGGGCGAAGGAGA from CPEB4) would be in the headline of an article in @elpais.com! Congrats to the Mendez, @xsalvatella1.bsky.social and @jjlucaslab.bsky.social labs for this amazing work!

english.elpais.com/science-tech...